marandajane marandajane
  • 19-01-2023
  • Biology
contestada

Transribe and translate the following dna strand
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Respuesta :

Otras preguntas

what can turn igneous rock into sediment?
4a + 3 - 9 = -7 + 2 + a
King Louis XVIA.He admired the revolution's principles.B.He was suspicious of the leaders of the revolution.C.He felt it was a much better revolution than the A
if 4 bags of corn can feed a herd of cows for 6 days, how many bags will feed the herd for 9 days ?
what can turn igneous rock into sediment?
the pair of polygons is similar. find the value of x. answer on picture
What's the answer to 1\2x+3=9
what can turn igneous rock into sediment?
what can turn igneous rock into sediment?
Choose the equation below that represents the line passing through the point (2, -4) with a slope of 1/2. A) y = 1/2 x + 5 B) y = 1/2 x - 3 C) y = 1/2 x - 5 D)