prsch6398 prsch6398
  • 16-04-2024
  • Mathematics
contestada

Find n(S ∩ T) given that n(S)=8, n(T)=10 and n(S∪ T)=18.
n(S∩ T)=___

Respuesta :

Otras preguntas

A circle is drawn within a square as shown. What is the best approximation for the area of the shaded region? Use 3.14 to approximate pi. 168.56 in² 696.08 in²
Which sti can cause blindness nervous system damage paralysis and dementia?
"Traits are passed from parentschool to offspring independitly of one another " is a what?
write and solve an equation to determine the value of x in each figure
The author of The Prince was
Dimi analyzed this system of equations and determined that there is no solution. y = 3x – 2 y + 2 = 3x Is he correct? A. Yes, because the lines represented by
Given f(x) =2x+5 and g(x)= x^2 - 4, find each of the following. {please help i have a test on it tomorrow}
who are the characters in the story of cosette side by side with the stranger in the dark?describe both of them
Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3
If a new substance forms during a chemical reaction but is dissolved in solution, what symbol should follow the chemical formula? a. (i) b. (s) c. ( g. d. (