queenbeautiful61307 queenbeautiful61307

18-11-2020
Mathematics

contestada

What’s the temperature after t minutes plssss helppp

Respuesta :

18-11-2020

Answer:

what does T equal

Step-by-step explanation:

Answer Link

Otras preguntas

why were the jews considered as undesirable?how were they treated in society?

There are 6 times as many males as females on the maths course at university. What fraction of the course are male? Give your answer in its simplest form.

A wall in Maria’s bedroom is in the shape of a trapezoid. The wall can be divided into a rectangle and a triangle. Using the 45°-45°-90° triangle theorem, find

Which adjective modifies the underlined word in this sentence? Our company's national sales meeting begins next week.

Why do plant cells become flaccid in concentrated sugar solution?

18. The servicing of a machine requires two separate steps, with the time needed for the first step being an exponential random variable with mean 0.2 hour and

Weaknesses and strengths of Britain and France as leaders of the League of Nations

GUAAUGAAACGCCUGGUAGAAGGUUGAUGC 1. List the DNA strand sequence from which the mRNA was transcribed: 2. List the complementary DNA sequence to the above DNA stra

Which type of triangles can be formed by taking the cross-section of a cube?

For a given rectangle, the length= 3x +2 and the width = 5. What is the area of the rectangle?