goawaymath goawaymath

21-10-2016
Mathematics

contestada

Shaniqua can read at a speed of 50 pages per hour. how many pages does she read on 1.5 hours?

Respuesta :

spoiledmilk spoiledmilk

21-10-2016

multiply 50 with 1.5 and the answer is 75 pages

Answer Link

Аноним Аноним

21-10-2016

shaniqua read overall 75 pages.

Answer Link

Otras preguntas

What is the least common denominator of the expression below? g^2 14+g _____ + _____ 9-g^2 24g+8g^2

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC

Digital communication should be used carefully and screened for unintentional meaning. True Or False

The ratio of the profit, material cost and production labour of an article is 5:7:13.If the material cost is 840 more than that of labour , find the total cost

PLEASE HELP!! Which equation can be used to solve 2 6 0 1 * x1 x2 = 2 -3

Why do governments create laws to reduce injury risks? to reduce the need for lifeguards at public pools to support research initiatives that find new ways to

Where should DoD employees look for guidance on safeguarding classified information?

A party's oral agreement to pay another's debt is never enforceable. A. True B. False

a total eclipse solar eclipse in 2003 lasted 5 3/20 minutes in Wizard viewed from the southern hemisphere the next total eclipse in 2005 lasted 3 2/3 minutes an

identify the gerund and gerund phrase in each of the following sentences?Facing his teacher was never frightening for him.gerundgerund phrase