4804378780 4804378780

18-02-2021
Biology

contestada

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Respuesta :

malakmohammed0101 malakmohammed0101

18-02-2021

CUGCUACAUCGUAGCUGGUAAC

Answer Link

Otras preguntas

When you are preparing an Air Mobility Command (AMC) Form 134, Mishandled Baggage Report, for a damaged bag, which of the following would represent a valid case

Is it better to get a credit card with a company you already have a credit card with or your mortgage?1.True2.False

Which of the following molecules contains a polar covalent bond?, d. NH3 a. H₂ b. PH3 C. F₂

Kris sees some students in the library. Then 10 more students enter the library. Now kris sees 20 students. How many students were in the library to start

Use this scenario to answer questions 3-7. You are interested in finding out how different AIR TEMPERATURES affect the SPEED at which gas molecules move. With a

Order 5 1/8, 5.04, 5, 5 2/20, 5.3 least to greatest

Spatial order is used when the writer wants to persuade or convince.A. TRUEB. FALSE

If there are two spots on the paper chromatography, What does this tell you about the composition of the sample?

Sandro Botticelli, Birth of Venus. c. 1485a) Venus emerges fully grown from the foam of the sea; faraway look in her eyes. b) Roses scattered before her; roses

Which of the following is NOT one of the four most common causes of injury?