ramirezmeneseag2370 ramirezmeneseag2370

16-03-2021
Mathematics

contestada

Enter the unknown value that makes this statement true. 25% of is 35

Respuesta :

27atkachenko 27atkachenko

16-03-2021

Answer:

25% of 140 is 35

Step-by-step explanation:

If 35 is 25% then we can multiply it by 4 to get 100%.

35 x 4=140

Answer Link

Otras preguntas

The room design cooling load is 3600 Btu/hr. The enthalpy of air leaving the cooling coil is 23 Btu/lbma. The room condition is 75 F db and humidity ratio of 0.

1. El alcalde y su esposa asistieron a la boda de Silvia y Carlos. 2. Todos los anuncios (announcements) describen eventos felices. 3. Felisa Vera de Larenas

1. Which of the following sentences is simple? A. The cat and mouse chased each other all day. B. The cat pounced, and the mouse jumped away just in time. C. Al

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to d

When one object heats another, does the temperature increase of one object always equal the temperature decrease of the other object? Explain

Read the following thesaurus entries. entry n. access, avenue, doorway, entrance, gate, portal entry n. debut, introduction, presentation entry n. competitor, c

4.38/322=X/267 solve for X

Iron reacts with oxygen in the air to make rust. Which of the chemical equations matches the reaction above? A. 4Fe + 3O2 2Fe2O3 B. 2I2 + 3CO2 2C3I2O3 C

PLEASE HELPPP!!! I will award brainliest!

A valley is low land between mountains, hills or plateaus. Like Yosemite Valley in the photograph, valleys often have rivers or streams flowing through them. Bu