18-11-2016
Biology

contestada

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT
TACGCGACGTGCACGTGCAA MRNA-----

Respuesta :

18-11-2016

I believe A translates to U, T transtates to A, G translates to C, and C traslates to G.

ATGCGCTGCACGTGCACGTTTACGCGACGTGCACGTGCAA

mRNA

UACGCGACGUGCACGUGCAAAUGCGCUGCACGUGCACGUU

Answer Link

Otras preguntas

We use the short ballot to elect the president, vice president, and members of Congress. a. True b. False

French settlers relied on trapping furs and trade with the Indians. True False

Solve for s. 2|s| = 18 A. s = –9 B. only s = 9 C. only s = –18 or s = 18 D. s = –9 or s = 9

the quotient of three times a number and 4 is at least -16

Which statements are true according to the order of operations? Choose exactly two answers that are correct. a. 32+8÷4=40÷4=10 b. 4+12÷2=4+6=10 c. (20–5)•3=1

a bedroom has perimeter of 46 feet. if the length of the the bedroom is 11 feet, what is the wigthof the bedroom.

Is the National Recovery Administration still around today?

a major renaissance work by machiavelli was

How would you write 5,392,029,004 in word form

In a sale there is 25% off all prices . A chair cost £45 in the sale . How much was it before the sale