vanityvillanueva
vanityvillanueva vanityvillanueva
  • 17-04-2021
  • Business
contestada

Similar Occupations to a singer

Respuesta :

eylumamaho7
eylumamaho7 eylumamaho7
  • 07-05-2021
Someone already answered but I want to do it too for points lol anyways. The answer is Sound editer, rapper, beat boxer.
Answer Link

Otras preguntas

was The Bill of Rights was part of the original draft of the Constitution
For vegetarians what does "balancing complementary proteins" mean?
Which of the following is a true statement about the growth of industry in the United States before the Civil War? A) Many people moved north to seek work. B)
what does each layer impact the structure of our planet
describe the motion of a pendulum in terms of kinetic and potential energy when it goes from its highest point to lowest point, how would the energy change?
Which statement is true about the expression 7(2x + 5) A. The expression has two factors B. The expression has three factors C. The factor (2x + 5) has three te
What are marjane satrapies parents names?
Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3
can somebody help me with this question
Social Security is an example of a government program that A-promotes the general welfare B-ensures domestic tranquility C-provides for the common defenseD-secu