trippyboirain trippyboirain

18-10-2021
Mathematics

contestada

Use the order of operations to simplify 19×3^3−2(1/6+2/3).

Respuesta :

animelovermanga77766 animelovermanga77766

18-10-2021

Answer:

Faction:1534/3

Decimal:511.3 repeating

Step-by-step explanation:

1st: Multiply 3^3, and multiply that by 19.

2nd:Add 1/6 +2/3

3rd:Multiply the 2nd answer by -2

4th:1st answer - 3rd answer

Answer Link

camisme12 camisme12

18-10-2021

The answer is either 511.333 or 1534/3

Answer Link

Otras preguntas

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

1.To access your course materials, such as reading assignments, textbooks, and other lesson content, it would be best to go to the

The Persian and Arabic word sharm can best be defined as _____. 1.) outspoken and shy 2.) embarrassed and bitter 3.) excluded and included 4.) shy and self-rest

Solve the system by elimination 3x - 2y + z = 0 6x + 2y +3z = -2 3x - 4y + 5z = 5

Christanity first began as an outgrowth of which religion?

explain the tenacity of the four-nation paradigm

(LC)Which sentence below shows correct use of em dashes? If the cat meows one more time I know – he will – I am going to have to get the treats. If the cat

What are the correct qualities of a poet

A spherical model of planet Earth has a radius of 3 ft. What is the approximate volume of the model of planet earth? Use 3.14 to approximate pi. Round to the ne

Which of the following is the most significant factor in social identity? A. Genetics B. Societal rules C. Clothing D. Height