Rodarte Rodarte
  • 16-12-2021
  • Mathematics
contestada

3x+y=-8 Find the equation of a line perpendicular to the above line.

Respuesta :

clarch19
clarch19 clarch19
  • 20-12-2021

Answer:

y = 1/3x

Step-by-step explanation:

use a slope that is the opposite and reciprocal of -3, which would be 1/3

Answer Link

Otras preguntas

Help please I’ll be very grateful \(0^0)/
Read this excerpt from an adaptation of “The Fox and the Cat” from Aesop’s Fables. Identify THREE instances of stage directions that explain the positions of th
HELP ASAP I NEED HELP AND I'M DESPERATE.
which sentence combines these two sentences using a coordinating conjunction?​
If 150 grams of a radioactive isotope are present at 2:00 PM and 10 grams remain at 6:00 PM (the same day), what is the half-life of the isotope? Round to two d
Which of the laws required the Treasury department to accept only gold and silver in payment for purchases of federal land?​
When a health provider uses social media and the site allows for responses, what is MOST important for the provider to plan for?
Devin is buying 2 concert tickets. The concert tickets have a regular price of $40 each. Devin has a coupon that gives a 5% discount off of the regular price of
Se lo qe es toy accendo? What does that mean?
Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (59)CTTAACACCCCTGACTTCGCGCCGTCG(39) (a) What