yorkies5167 yorkies5167

19-05-2022
Medicine

contestada

Compared to formula-fed infants, breastfed infants tend to have ______ risk for atopic diseases, such as asthma and eczema

Respuesta :

audreypence06 audreypence06

19-05-2022

Answer:

I think it would be Reduced Risk

Explanation:

Answer Link

Otras preguntas

By the end of the Reconstruction era, many Americans were forced to use their current year’s profits to pay for last year’s debt. This phenomenon was known as t

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

every human being started as a single__________ cell.

5(x+9) in the distributive property

Which of the following is a true statement about the growth of industry in the United States before the Civil War? A) Many people moved north to seek work. B)

What were the Great purges

Multiply 1 over 3 multiplied by 1 over 5.

The introspection method was invented by _____________. John Watson William James Wilhelm Wundt Sigmund Freud

Estimate: 92% of 104

An element is composed of at least two kinds of atoms. True False