markkessler8919 markkessler8919
  • 19-05-2022
  • History
contestada

Which conclusion can be made about most revolutions throughout world history ?

Respuesta :

addybbear
addybbear addybbear
  • 30-05-2022

Answer:

techology has changed the world for the worse and the better

Explanation:

Answer Link

Otras preguntas

Help me with this question plz
Which of the following is NOT true about alcohol absorption? Alcohol can be diffused from the stomach lining into the bloodstream. Almost 80 percent of alcohol
Which one is destitution synonym, is it hardship, notoriety, culture, or politics
You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to d
what imformation does the pH of solution give?
Create a method remove Evens that removes all even elements from an ArrayList of Integers. The method should also print all the remaining items in the ArrayList
Our text claims that a charged particle exerts a net attractive force on an electric dipole. The purpose of this exercise is to investigate this phenomenon. Sup
How could you argue that the Holocaust was the defining moment of World War 2? THINK ABOUT: Human rights, Nazism, Genocide
Who was the first president
The American Revolution can be interpreted as