leonxd154 leonxd154
  • 21-06-2022
  • English
contestada

Can anybody help me find the right answer?

Can anybody help me find the right answer class=

Respuesta :

NotFoster NotFoster
  • 21-06-2022

Answer:

Length

Explanation:

It is im pretty sure

Answer Link

Otras preguntas

Look at the photo please
How do the number of calories from fat in a serving of each cereal compare?
For a charity event, raffle tickets are printed such that they have a vowel (excluding y) as the first character and a prime number less than 10 as the second d
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Determine whether the triangles are congruent by, sss, sas, asa, aas, or hl
2a+ 3b + 4a^2 - 9b^2​
Native bumblebees live in grasslands and consume pollen and nectar from flowers. The bumblebees carry pollen from one plant to another. The bees pollinate most
Prisicas built a cabinet shaped like a rectangular prism .The length base is 9 inches and the width is 40 inches what is the area of the base of the cabinet in
could i have help on these two very short multiple choice questions on christianity?
Yo how y’a doin. ✌️