a3gholetggarcer a3gholetggarcer

21-03-2017
Mathematics

contestada

What is the slope of the line that passes through the points (3, 4) and (5, –4)?

Respuesta :

TheHero TheHero

24-03-2017

m = -4 -4 / 5- 3 = -8/2 = -4

y = -4x + b

4 = -12 + b

b = 16

y = -4x + 16

Answer Link

Otras preguntas

What are atoms that vary in the number of neutrons found in their nuclei called?

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC

When the potential energy is lowest, what is true of the kinetic energy?

¡Saludos desde el mar hermoso en Chile! Soy Emilia y estoy aquí en Valparaíso con mi novio Jacobo. Cerca de nuestro hotel hay casas de muchos colores. Para baja

During AM care, what do nursing assistants do for catheterized patients?clip their catheter tubingclip their drainage bagsempty their bladdersempty their draina

What is the first derivative of p with respect to q (i.e., differentiate P with respect to q)?P = 6q2 + 3

What are the solutions of the equation 3x^2+6x-24=0

In what way is the study of psychology similar to other “hard sciences”? A. use of the scientific method B. use of memory C. use of emotion D. use of behavior

Early this morning the temperature was 54°F Fahrenheit around noon the temperature increase 45° at 5 PM a north wind made the temperature for 49°F but just befo

Nuclear binding energies for the fusion of a mole of nuclei typically correspond to mass differences on the order of: A. grams B. milligrams C. micrograms D