21-01-2018
Social Studies

contestada

How do u use a washing machine

Please give steps
Washing machine : LG black 6/9kg

Respuesta :

Snowflakelove319 Snowflakelove319

21-01-2018

1. if not already open, open the lid

2. place clothes in, around the central circular shape

3. pour in detergent wherever detergent is incerted

4. close lid and set the desired setting

5. start the washing cycle!

Answer Link

Otras preguntas

ok fr I need to stop ima get banned lol last one yallll

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

The sharper the sound is the smaller the frequency of a vibrating body true or false

The use of alcohol and other drugs by the operator of a motor vehicle reduces then eliminates your ability to safely operatea motor vehicle. Oa) true Ob) false

Simplify the Following 8-√-24 ———— divided by 4

question 14 if QS is an angle bisector of PQR and PQR = 140, find the measurement of PQS

Of the following two gases, which would you predict to diffuse more rapidly? Ar or He

Mike's monthly pay after taxes is $2,300. He spends 30% of his pay on rent and 10% on utilities. He saves 5% of his pay each month. • He gives To of his pay to

Which step to transform Turkish life was not taken by its leader after Turkey gained its independence? O changing the Turkish alphabet to Latin letters O creati

4 × 22 + 16 ÷ 4 - (4.9 + 5.5)