jkarag2917p6qxdy
jkarag2917p6qxdy jkarag2917p6qxdy
  • 19-04-2018
  • Mathematics
contestada

is 3km greater less or equal to 5000 m

Respuesta :

Аноним Аноним
  • 19-04-2018
Less than, because 3km is equal to 3000 meters.

3km < 5000m
Answer Link
VanillaVan
VanillaVan VanillaVan
  • 19-04-2018
5000m is greater than 3km because 1k= 1000m
Answer Link

Otras preguntas

I need to name the type of special pairs of angles shown. Please and thank you​
What is the difference between christendom and christianity
At the farmers’ market, two pounds of peaches cost $4.20. How much will give pounds cost?
*ANSWER FAST* x-1/x-2 + x-3/x-4 = 3 1/3 [x≠2 , x≠4] find
6х + Зу = 12solve for y ​
Please help ASAP 100 points please :((
Factorise the following completely 6x(squared) + 11xy + 5y(squared)
Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC
What was true about President Franklin D. Roosevelt?A. He came from a poor family.B. He was seen as a friend to the common person.C. He was highly popular with
A 0.40 kg mass hangs on a spring with a spring constant of 12 N/m. The system oscillated with a constant amplitude of 12 cm. What is the maximum acceleration of