Hopinq
Hopinq Hopinq
  • 20-04-2018
  • Mathematics
contestada

Haaaaaaaalp meeeeeeee

Haaaaaaaalp meeeeeeee class=

Respuesta :

destiq20
destiq20 destiq20
  • 20-04-2018
The answer is A. W (weight) must be LESS than 20 (w<20) and the weight has to be a positive number because the weight of a dog cannot be negative.
I hope this helps! ^-^
Answer Link

Otras preguntas

An object moves at a constant speed what will happen to this objects motion over time if no new forces are applied
[tex]x ^{2} - 10x + 16 = 0[/tex]
if polygons are similar then what do you know about the corresponding sides and the corresponding angles?
Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
What is the purpose of figurative language? What jobs does it do?
PLEASE HELP ASAPPP!!!!!!!!!!!!!!!
What is the measure of Angle 1
Which statement best describes how the topic of death is treated differently in "An Irish Airman Foresees His Death" and "Do not go gentle into that good night"
How is it going to tell me the answer
Explain why a person with aids may also have pneumonia