Seudónimo Seudónimo
  • 18-02-2016
  • Mathematics
contestada

What is 2. In its simplest form
_
8

Respuesta :

EXODRONE
EXODRONE EXODRONE
  • 20-02-2016
If your looking for the answer for 2
                                                    _
                                                    8
in simplest form then it's 1
                                       _   or 0.25
                                       4
Answer Link

Otras preguntas

What two major landforms define Brazil?
what happens mostly at every witch hunt
Kaya found 25 shells on the beach yesterday.Today she found 25 more shell. She sorted all the shells into 5pile.Which equation can be used to find how many shel
according to the theory of plate tectonics what forces cause the movement of plates in the Earth's crust
Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
The area of a regular octagon is 25 square cm . What is the area of a regular octagon with sides five times as large as the sides of the first octagon?
2 3/4,1 1/2 and3 3/8 in decimals, how many total miles did the person hike?
A 12 foot tall building casts an 8 foot shadow. How long will a 5 foot tall woman have?
A carnival game allows a group of players to each draw and keep a marble from a bag. The bag contains 5 gold marbles, 25 silver marbles, and 70 red marbles. A p
How many moles of tin atoms are in a pure tin cup with a mass of 37.6 g ?