devenharris devenharris

20-10-2020
Mathematics

contestada

there are 18 pencils for $2.36 how much would it be for one

Respuesta :

tnichols732 tnichols732

20-10-2020

Answer:

13 cents

Step-by-step explanation:

2.36/18= 0.13

Answer Link

Otras preguntas

a civilization whose impact can be felt on history for a very long time is called_____

Under Roman law, someone accusing another person of a crime needed belief that the accused was guilty. proof that a crime had been committed. a lawyer willing

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

what is the answer to 10324 divided by 12 show the work

Please help me with problems 29,30,31,36, and 37

To check if a stovetop is hot, you place you hand near the top of the stove and feel that it is warm without touching it. You can feel the heat from the stove t

Enter the trigonometric equation (sin, tan, or cos) you would use to find x in the following right triangles.

The City Zoo Had An Equal Number Of Visitors On Saturday And Sunday In All 32096 People Visited The Zoo That Weekend How Many Visited Each Day The Chart Shows

Sports medicine experts consider dynamic stretching a better way to reduce muscle tightness than traditional stretching. True False

Read the excerpt from The Odyssey. But when he knew he heard Odysseus' voice nearby, he did his best to wag his tail, nose down, with flattened ears, having n