Savemepeep
Savemepeep Savemepeep
  • 17-12-2020
  • English
contestada

what is the best summary of this selection?

what is the best summary of this selection class=

Respuesta :

lovelygodlover24
lovelygodlover24 lovelygodlover24
  • 22-12-2020

Answer:

H

Explanation:

because it's a bit longer and not just because of that is because it provides a bit more details and it actually sounds like it's sums up the whole story rather than the other ones it seems like they continue the story more than ending it there

Answer Link

Otras preguntas

How can you use your answer to determine if the tour guide rented enough vans
I need help with this please !!!!
Which Renaissance figure ably ruled the city-state of Mantua while her husband was a prisoner of the Venetians and eventually secured his release? Question 6 op
How do you say "my" in german
what are three formulas for resistance in a parallel circuit
It is generally a good idea to gain an understanding of the \"size\" of units. consider the following objects and calculate their kinetic energy in si units.
What is a deathologist and what do they believe
Sin(sin ^-1 π) Select the correct below, and if necessary, fill in the answer box to complete your choice. a) Sin(sin^-1 π) = ____ (type an integer or a simpli
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
When a graph has moved either up or down it has made a ____ ____.