Luvaaanene Luvaaanene
  • 18-05-2021
  • Mathematics
contestada

Find the value of YVU

Find the value of YVU class=

Respuesta :

jessicajacob25 jessicajacob25
  • 18-05-2021
XV = 180
180 - 85 = 95
Answer Link

Otras preguntas

Progressive companies who want to attract and keep good employees are now offering their employees ________ benefits, such as onsite dry cleaning services, shoe
8% of 70 is what number
Please help with this cuestion,Is minus or plus .mr durham Had 82 fiction book on her shelves and 58 non-fiction book.what Is the total number of book on her sh
Three less than X is equal to 13
How does "As I Lay Dying" most meet the definition of Modernist literature? A. The characters are exaggerated and unrealistic. B. It uses stream of consci
Choose all that apply. Three of the common characteristics of hunter-gatherer communities were _____. they stayed in one place for long periods of time their co
Which best explains the term flash-forward in fiction? A. When the author chooses to reveal important information B. A sense in the story that the action
what is the estimated perimeter of an ellipse if the major axis has a length of 15 ft and minor axis has a length of 7.5 ft? round your answer to the nearest te
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
Taryn conducted a science experiment on saturation. She added sugar to a sugar-water solution at different intervals. The graph shows how much sugar was in the