25tuckhannah
25tuckhannah
17-09-2021
History
contestada
Please help need fast today
Respuesta :
jojoakaziah
jojoakaziah
17-09-2021
Thomas Edison = Electric Lightbulb
The Wright Brothers = Airplane
Samuel Morse = Telegraph
Alexander Graham Bell = Telephone
Henry Ford = Assembly Line
Hope this helps!
Answer Link
VER TODAS LAS RESPUESTAS ( 23+ )
Otras preguntas
By computing the present value of the principal paid at maturity and all interest payments to be made over the term of the bond, you can obtain the ________ of
It takes a car 1.75 h to go from mile marker 115 what's the average speed of the car?
Which is the most effective topic for a compare-and-contrast essay? The History of Toy Commercials in America, The Filming of a Famous Toy Commercial, How Toy C
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
I need help is it A B C or D
How successful was the Japanese attack on Pearl Harbor? Did they accomplish the objectives they set out to accomplish? Explain why or why not.
How does a ribosome know how to make protein A. The instructions come through a transmembrane protein and travel to the ribosome B. The necessary enzymes trav
Prior to the 1500s, the main scientific view regarding the solar system was that _________ was at the center of the universe. a. the moon b. heaven c. the su
Mandarin Chinese is not spoken widely outside of China, yet it is spoken by more people than any other language. What makes this possible?
Which equation was used by Albert Einstein to explain the photoelectric effect? [E = energy, h = Planck’s constant, and v = frequency.] E = h/v E = hv E = v/h E
