ariellewallenst8895 ariellewallenst8895
  • 20-09-2022
  • Mathematics
contestada

Write and solve a word problem that can be modeled by the quotient-84 divided by 3

Respuesta :

elliottn089
elliottn089 elliottn089
  • 20-09-2022

Answer:

-28

Step-by-step explanation:

-84/3=-28

-28 is the answer to the problem

Answer Link

Otras preguntas

What is .5333 as a fraction?
What is one natural resource people use in their homes everyday??? -_-
Let f (x)=X2 -x. if (x)=132, then what is the value of x?
How do you say "Slow" in German
The powerhouse of the cell: that is a term used to describe the ______________, because it's main function is to produce energy for cellular activities. A) nucl
This question is asking to label the following cells. One should be an animal and the other should be a plant. Please help me, I will be glad if you do! ~Aurora
Direct stock plans are only offered by brokerage firms? True or False
In RST, RS = 7, RT = 10, and ST = 8. Which angle of RST has the smallest measure?
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
How does the following quote support the theme of darkness in the text? "Never shall I forget that night, the first night in the camp which has turned my life i