lila1432 lila1432
  • 18-03-2017
  • Mathematics
contestada

anybody know the solution for
2x-2y=14
9x+4y=37

Respuesta :

Vesper02
Vesper02 Vesper02
  • 18-03-2017
(5,-2)

x = 5
y = -2

2(5)-2(-2)=10--4=14
9(5)+4(-2)=45-8=37
Answer Link

Otras preguntas

Someone please help i have at get this done by tonight
Animals in the mammal group called______ allow there young to develop in a pouch on their mother's body
36 ÷ 3^2 +4*2-1 can u help me get the answer?
You write a short story, but want to make sure your work is protected before you post it online. What should you do to help protect your copyright?
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
What is the name of the organization responsible for assigning public ip​ addresses?
True or False The Color field painting called No. 10, 1952 by mark Rothko and the Homage To The Square painting by Josef Albers are both nonrepresentational.
More help! I upvote every response. :D The results from the BMi calculator are always 100% correct. False True
What idea is related in both excerpts?
how to do simplifie 5d-13<32