morenoclarisa1 morenoclarisa1

19-03-2018
Mathematics

contestada

what is the length of the transverse axis of the conic section show below ? (y+2)^2/16-(x-3)^2/9=1

Respuesta :

AverageTidePod AverageTidePod

19-03-2018

Would th eanswer be two solutions are the points (0,-4) and (0,4).

Answer Link

turanganik turanganik

19-07-2018

the answer is 8 for all you APEX kids

Answer Link

Otras preguntas

What role did John Adams play in the Boston Massacre trials?

Gnp is a better measure of total economic output in the u.s. than gdp. a. true b. false

When Devon cashed a $450 check at the bank, the teller gave him 18 bills, all $20 bills and $50 bills. Which system of equations can be used to find how many of

When Stephanie was 13 years old she had 137 baseball cards. Each year for her birthday she got 25 more. Stephanie is now 28 years old. Assuming Stephanie has no

what is a rhythmic disturbance that carries energy through matter or space

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

true or false: hazing is not violence because all parties involved are voluntary

You have 97 followers on your social page. Only 3% of them are active. Out of, how many followers (in decimal) are active?

Jenny's frog made one jump of 2.34 m. Christina's frog made jumps of 1.22 m and 0.89 m. How much further did Jenny's frog jump in one jump than Christina's frog

Which type of assessment is used to evaluate how well a person performs a task